Skip to main content

Table 1 Sequence of primers used for real time RT-PCR.

From: MyD88-dependent and independent pathways of Toll-Like Receptors are engaged in biological activity of Triptolide in ligand-stimulated macrophages

Gene symbol* (accession#) Forward primer Reverse primer
β-actin (NM_007393) 5'AACCGTGAAAAGATGACCCAGAT3' 5'CACAGCCTGGATGGCTACGT3'
COX-2 (NM_011198) 5'TGGTGCCTGGTCTGATGATG3' 5'GTGGTAACCGCTCAGGTGTTG3'
iNOS (XM_147149) 5'CCCTCCTGATCTTGTGTTGGA3' 5'TCAACCCGAGCTCCTGGAA3'
MyD88 (NM_010851) 5'TGGCCTTGTTAGACCGTGA3' 5'AAGTATTTCTGGCAGTCCTCCTC3'
TRIF (NM_174989) 5'TGGCAAACACCTTCAAGACA3' 5'GCGCTTTCTTCCAGCGTA3'
CCL3 (NM_011337) 5'TGCCCTTGCTGTTCTTCTCT3' 5'GTGGAATCTTCCGGCTGTAG3'
IRG1 (NM_008392) 5'GCTTTTGTTAATGGTGTTGCTG3' 5'GGCTTCCGATAGAGCTGTGA3'
TLR2 (NM_011905) 5'GGGGCTTCACTTCTCTGCTT3' 5'AGCATCCTCTGAGATTTGACG3'
TLR3 (NM_126166) 5'GATACAGGGATTGCACCCATA3' 5'TCCCCCAAAGGAGTACATTAGA3'
TLR4 (NM_021297) 5'GGACTCTGATCATGGCACTG3' 5'CTGATCCATGCATTGGTAGGT3'
  1. *Refer to abbreviation list for full gene names